ORK01192

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01192

Order Kazusa clone(s) from :

Accession No	AB210023
Product ID	ORK01192
Clone name	ha02979
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	STAG1
cDNA sequence	DNA sequence (4886 bp) Predicted protein sequence (1275 aa)
HaloTag ORF Clone	FHC01192
Flexi ORF Clone	FXC01192
Description	Cohesin subunit SA-1 (Stromal antigen 1) (SCC3 homolog 1).

Features of the cloned cDNA sequence

Description

Length: 4886 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	852 bp
Genome contig ID	gi89161205r_137438934
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTCTACCAGCAAATAAAGTATTCTCAGTAAAACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGATTCTCAAGTTATCAGTTTGCTGTTTTTACCACTTATTTCATGC

Features of the protein sequence

Description

Length: 1275 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06105	100.0	STAG1 variant p...	Homo sapiens
EAW79115	100.0	stromal antigen...	Homo sapiens
XP_001154214	99.9	stromal antigen...	Pan troglodytes
XP_001789760	99.7	similar to stro...	Bos taurus
Q8WVM7	99.8	Cohesin subunit...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013721	174	293	PF08514	STAG

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp