ORK01219

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01219

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01219
Clone name	sh02130
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CD101
cDNA sequence	DNA sequence (5513 bp) Predicted protein sequence (1031 aa)
HaloTag ORF Clone	FHC01219
Flexi ORF Clone	FXC01219
Description	Immunoglobulin superfamily member 2 precursor (Glu-Trp-Ile EWI motif- containing protein 101) (EWI-101) (Cell surface glycoprotein V7) (CD101 antigen).

Features of the cloned cDNA sequence

Description

Length: 5513 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2416 bp
Genome contig ID	gi89161185f_117245932
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGTATTCCCAGCGCTCTCCTTGCTTGTGACAAGT
Flanking genome sequence (134732 - 134781)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAACTCCTTTTCATCAAAACTCATGTTCTTGTGGAGAG

Features of the protein sequence

Description

Length: 1031 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW56664	99.9	immunoglobulin ...	Homo sapiens
CAH71959	100.0	immunoglobulin ...	Homo sapiens
AAI30328	99.8	IGSF2 protein [...	Homo sapiens
Q93033	99.4	Immunoglobulin ...	Homo sapiens
XP_524815	98.1	similar to immu...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	31	153	PF07686	Immunoglobulin V-set
	IPR013151	171	261	PF00047	Immunoglobulin
	IPR013151	307	389	PF00047	Immunoglobulin
	IPR013151	565	652	PF00047	Immunoglobulin
	IPR013151	837	921	PF00047	Immunoglobulin
HMMSmart	IPR003599	38	153	SM00409	Immunoglobulin subtype
	IPR003596	48	133	SM00406	Immunoglobulin V-set
	IPR003599	163	288	SM00409	Immunoglobulin subtype
	IPR003596	173	261	SM00406	Immunoglobulin V-set
	IPR003596	284	389	SM00406	Immunoglobulin V-set
	IPR003599	299	405	SM00409	Immunoglobulin subtype
	IPR003599	429	545	SM00409	Immunoglobulin subtype
	IPR003599	557	680	SM00409	Immunoglobulin subtype
	IPR003599	692	817	SM00409	Immunoglobulin subtype
	IPR003599	830	949	SM00409	Immunoglobulin subtype
	IPR003596	839	921	SM00406	Immunoglobulin V-set
ProfileScan	IPR007110	45	142	PS50835	Immunoglobulin-like
	IPR007110	154	262	PS50835	Immunoglobulin-like
	IPR007110	289	399	PS50835	Immunoglobulin-like
	IPR007110	418	535	PS50835	Immunoglobulin-like
	IPR007110	570	661	PS50835	Immunoglobulin-like
	IPR007110	682	791	PS50835	Immunoglobulin-like
	IPR007110	818	921	PS50835	Immunoglobulin-like
ScanRegExp	IPR002195	410	418	PS00482	Dihydroorotase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	VLAQMAGISYVASFFLLLTKLSI	29	SECONDARY	23
SOSUI2	2	964	PLLYFLFICPFVLLLLLLISLLC	986	PRIMARY	23