ORK01236

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01236

Order Kazusa clone(s) from :

Accession No	AB208804
Product ID	ORK01236
Clone name	ph01059
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ph01059 has an irregular adapter sequence (GTCGACCCAC GCGTCCGA) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	AP3D1
cDNA sequence	DNA sequence (5064 bp) Predicted protein sequence (1284 aa)
HaloTag ORF Clone	FHC01236
Flexi ORF Clone	FXC01236
Description	AP-3 complex subunit delta-1 (Adapter-related protein complex 3 subunit delta-1) (Delta-adaptin 3) (AP-3 complex subunit delta) (Delta-adaptin).

Features of the cloned cDNA sequence

Description

Length: 5064 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1209 bp
Genome contig ID	gi42406306r_1951994
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGCAAAAAAAAAAAAAAAAAGTTCTAGATCGCGA
Flanking genome sequence (250547 - 250498)	----+--------+--------+--------+--------+----* GCAGGGGATCGCCGAGGCCGCCGGGGCCACCTGGGCAGAGCGCGAGCAGG

Features of the protein sequence

Description

Length: 1284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92041	100.0	Adapter-related...	Homo sapiens
BAG10594	100.0	AP-3 complex su...	synthetic construct
XP_001149847	99.5	adaptor-related...	Pan troglodytes
BAF62313	88.5	adaptor-related...	Sus scrofa
Q865S1	88.7	AP-3 complex su...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002553	101	652	PF01602	Clathrin/coatomer adaptor
HMMPfam	IPR010474	713	1282	PF06375	Bovine leukaemia virus receptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	341	AMSLLYECVNTVIAVLISLSSGM	363	PRIMARY	23