ORK01245

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01245

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01245
Clone name	fk07061
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DPP6
cDNA sequence	DNA sequence (3630 bp) Predicted protein sequence (842 aa)
HaloTag ORF Clone	FHC01245
Flexi ORF Clone	FXC01245
Description	Dipeptidyl aminopeptidase-like protein 6 (Dipeptidylpeptidase VI) (Dipeptidylpeptidase 6) (Dipeptidyl peptidase IV-like protein) (Dipeptidyl aminopeptidase-related protein) (DPPX).

Features of the cloned cDNA sequence

Description

Length: 3630 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	976 bp
Genome contig ID	gi89161213f_153533271
PolyA signal sequence (None)	+--------+--------+----*----+---- GTACCGTATCAAGCTCTTTCCCATGACATTTGGTT
Flanking genome sequence (782825 - 782874)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAAAAAAAAAAAAAAAAAACAGAAAAAAGACAAAGCGTCA

Features of the protein sequence

Description

Length: 842 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10605	100.0	dipeptidyl amin...	synthetic construct
AAA35761	99.8	dipeptidyl amin...	Homo sapiens
EAX04522	99.8	dipeptidyl-pept...	Homo sapiens
Q5IS50	99.3	Dipeptidyl amin...	Pan troglodytes
P42658	99.1	Dipeptidyl amin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002469	172	538	PF00930	Peptidase S9B
HMMPfam	IPR001375	618	827	PF00326	Peptidase S9

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	74	AIALLVILVICSLIVTSVILLTP	96	PRIMARY	23