Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01251
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01251
Clone name hj05937
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PPP2R1A
cDNA sequence DNA sequence (2211 bp)
Predicted protein sequence (590 aa)
Flexi ORF Clone FXC01251
Description Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform (PP2A, subunit A, PR65-alpha isoform) (PP2A, subunit A, R1-alpha isoform) (Medium tumor antigen-associated 61 kDa protein).
Features of the cloned cDNA sequence

Length: 2211 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 436 bp
Genome contig ID gi42406306f_57285157
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
TCCCCCTTTTCACAGAGAAATAAAGGTCTAGAAGT
Flanking genome sequence
(136327 - 136376)		 
----+----*----+----*----+----*----+----*----+----*
AGTTGGTCCTCTGGCCTTAGTCATCAGCTTGGAGGAGGGGGCACCACCCC

Features of the protein sequence

Length: 590 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P30153 0 100.0 Serine/threonin...
 Homo sapiens
AAP36766 0 100.0 protein phospha...
 synthetic construct
P54612 0 99.8 Serine/threonin...
 Sus scrofa
1B3U 0 100.0 PROTEIN (PROTEI...
 Homo sapiens
BAC40565 0 99.6 unnamed protein...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 84 120 PF02985 HEAT
IPR000357 161 197 PF02985 HEAT
IPR000357 200 236 PF02985 HEAT
IPR000357 239 275 PF02985 HEAT
IPR000357 278 314 PF02985 HEAT
IPR000357 321 357 PF02985 HEAT
IPR000357 360 396 PF02985 HEAT
IPR000357 399 435 PF02985 HEAT
IPR000357 438 474 PF02985 HEAT
IPR000357 477 513 PF02985 HEAT
IPR000357 516 552 PF02985 HEAT
ProfileScan IPR000357 13 51 PS50077 HEAT
IPR000357 90 128 PS50077 HEAT
IPR000357 167 205 PS50077 HEAT
IPR000357 206 244 PS50077 HEAT
IPR000357 245 283 PS50077 HEAT
IPR000357 284 321 PS50077 HEAT
IPR000357 327 365 PS50077 HEAT
IPR000357 366 404 PS50077 HEAT
IPR000357 405 443 PS50077 HEAT
IPR000357 522 560 PS50077 HEAT
IPR000357 561 590 PS50077 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp