ORK01258

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01258

Order Kazusa clone(s) from :

Accession No	AB208898
Product ID	ORK01258
Clone name	fk12713
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	OSBPL6
cDNA sequence	DNA sequence (3637 bp) Predicted protein sequence (966 aa)
HaloTag ORF Clone	FHC01258
Flexi ORF Clone	FXC01258
Description	Oxysterol-binding protein-related protein 6 (OSBP-related protein 6) (ORP-6).

Features of the cloned cDNA sequence

Description

Length: 3637 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	213 bp
Genome contig ID	gi89161199f_178667454
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGATCCTTTCTGTTTTGCTGCAACCATATTCCTT
Flanking genome sequence (301293 - 301342)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAATCCACACCGTCCTTGGAAAGCA

Features of the protein sequence

Description

Length: 966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92135	100.0	oxysterol-bindi...	Homo sapiens
EAX11042	100.0	oxysterol bindi...	Homo sapiens
XP_872029	98.1	similar to oxys...	Bos taurus
Q8BXR9	97.8	Oxysterol-bindi...	Mus musculus
NP_663500	97.0	oxysterol bindi...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	94	188	PF00169	Pleckstrin-like
HMMPfam	IPR000648	564	954	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	94	190	SM00233	Pleckstrin-like
ProfileScan	IPR001849	93	188	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	702	713	PS01013	Oxysterol-binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp