Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01259
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01259
Clone name fk16360
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MTHFD1
cDNA sequence DNA sequence (3224 bp)
Predicted protein sequence (990 aa)
Flexi ORF Clone FXC01259
Description C-1-tetrahydrofolate synthase, cytoplasmic (C1-THF synthase) [Includes: Methylenetetrahydrofolate dehydrogenase (EC 1.5.1.5); Methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9); Formyltetrahydrofolate synthetase (EC 6.3.4.3)].
Features of the cloned cDNA sequence

Length: 3224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 250 bp
Genome contig ID gi51511730f_63824733
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGACGTTCCACAGAATAAAAGGAAACAAGTTTGCC
Flanking genome sequence
(171744 - 171793)
----+----*----+----*----+----*----+----*----+----*
ATCTTGGTGTTGCAATATGAATTACAGCCTTAACAGACTGTGCCACAGGT

Features of the protein sequence

Length: 990 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001170520 0 99.3 methylenetetrah...
Pan troglodytes
XP_510001 0 99.2 methylenetetrah...
Pan troglodytes
AAH09806 0 100.0 Methylenetetrah...
Homo sapiens
P11586 0 99.8 C-1-tetrahydrof...
Homo sapiens
AAH50420 0 99.7 Methylenetetrah...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000672 65 185 PD002300 Tetrahydrofolate dehydrogenase/cyclohydrolase
FPrintScan IPR000672 91 113 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 132 159 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 169 190 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 216 236 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 265 294 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 306 322 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 323 341 PR00085 Tetrahydrofolate dehydrogenase/cyclohydrolase
HMMPfam IPR000672 60 180 PF00763 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 183 350 PF02882 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000559 371 990 PF01268 Formate-tetrahydrofolate ligase
ScanRegExp IPR000672 133 158 PS00766 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000672 327 335 PS00767 Tetrahydrofolate dehydrogenase/cyclohydrolase
IPR000559 474 484 PS00721 Formate-tetrahydrofolate ligase
IPR000559 753 764 PS00722 Formate-tetrahydrofolate ligase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp