Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01308
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209063
Product ID ORK01308
Clone name hk00282
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PHC1
cDNA sequence DNA sequence (4189 bp)
Predicted protein sequence (1099 aa)
Flexi ORF Clone FXC01308
Description Polyhomeotic-like protein 1 (hPH1) (Early development regulatory protein 1).
Features of the cloned cDNA sequence

Length: 4189 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 842 bp
Genome contig ID gi89161190f_8858416
PolyA signal sequence
(AGTAAA,-20)
+----*----+----*----+----*----+----
AATATTTTTTTCCTCAGTAAAAGGATGAAAATTGG
Flanking genome sequence
(125750 - 125799)
----+----*----+----*----+----*----+----*----+----*
TTTCAGTTGTCTTACTCTATTCCAGTCTTTGCCCACTTTCACACAAATGA

Features of the protein sequence

Length: 1099 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92300 0 100.0 Polyhomeotic-li...
Homo sapiens
XP_939259 0 99.2 similar to poly...
Homo sapiens
XP_520827 0 99.1 polyhomeotic 1-...
Pan troglodytes
XP_001118435 0 98.2 similar to poly...
Macaca mulatta
EAW88600 0 100.0 polyhomeotic-li...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001660 1033 1097 PF00536 Sterile alpha motif SAM
HMMSmart IPR001660 1032 1099 SM00454 Sterile alpha motif SAM
ProfileScan IPR012313 886 920 PS51024 Zinc finger
IPR001660 1035 1099 PS50105 Sterile alpha motif SAM
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp