ORK01314

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01314

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01314
Clone name	hk03782
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	POLR2B
cDNA sequence	DNA sequence (3795 bp) Predicted protein sequence (1186 aa)
HaloTag ORF Clone	FHC01314
Flexi ORF Clone	FXC01314
Description	DNA-directed RNA polymerase II subunit RPB2 (EC 2.7.7.6) (RNA polymerase II subunit B2) (DNA-directed RNA polymerase II subunit B) (RNA polymerase II subunit 2) (DNA-directed RNA polymerase II 140 kDa polypeptide).

Features of the cloned cDNA sequence

Description

Length: 3795 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	170 bp
Genome contig ID	gi89161207f_57439809
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTCTGTAAATATATAATAAATTTTTGTAGATAGTC
Flanking genome sequence (152274 - 152323)	----+--------+--------+--------+--------+----* TTGATGTGTGATCTTTATTTTGTATTTCTCTGTGTAAAACCAGTGAATAT

Features of the protein sequence

Description

Length: 1186 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001083325	100.0	DNA directed RN...	Macaca mulatta
P30876	100.0	DNA-directed RN...	Homo sapiens
XP_001916826	99.9	similar to DNA-...	Equus caballus
AAI42268	99.9	POLR2B protein ...	Bos taurus
Q8CFI7	99.9	DNA-directed RN...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007644	50	463	PF04563	RNA polymerase
	IPR007642	213	406	PF04561	RNA polymerase Rpb2
	IPR007645	480	545	PF04565	RNA polymerase Rpb2
	IPR007646	579	642	PF04566	RNA polymerase Rpb2
	IPR007647	665	712	PF04567	RNA polymerase Rpb2
	IPR007120	717	1092	PF00562	RNA polymerase Rpb2
	IPR007641	1094	1186	PF04560	RNA polymerase Rpb2
ScanRegExp	IPR007121	944	956	PS01166	RNA polymerase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp