ORK01316

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01316

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01316
Clone name	hk07633
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	STAT2
cDNA sequence	DNA sequence (4239 bp) Predicted protein sequence (916 aa)
HaloTag ORF Clone	FHC01316
Flexi ORF Clone	FXC01316
Description	Signal transducer and activator of transcription 2 (p113).

Features of the cloned cDNA sequence

Description

Length: 4239 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1487 bp
Genome contig ID	gi89161190r_54921651
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGCAGAAATGGCTAATAAACTTTGTGCTGATCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTCTCATCTCTGATCCTCTTTATTTCCCTGCTCACAAAGGCTAATG

Features of the protein sequence

Description

Length: 916 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P52630	100.0	Signal transduc...	Homo sapiens
XP_001168971	99.5	signal transduc...	Pan troglodytes
BAG59489	99.4	unnamed protein...	Homo sapiens
BAE00059	97.7	signal transduc...	Chlorocebus aet...
XP_001115072	97.0	signal transduc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	637	705	PD000093	SH2 motif
HMMPfam	IPR013799	67	190	PF02865	STAT transcription factor
	IPR013800	204	379	PF01017	STAT transcription factor
	IPR013801	381	631	PF02864	STAT transcription factor
	IPR000980	637	713	PF00017	SH2 motif
HMMSmart	IPR000980	635	719	SM00252	SH2 motif
ProfileScan	IPR000980	637	732	PS50001	SH2 motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp