Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01360
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01360
Clone name fj20320
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FBXO18
cDNA sequence DNA sequence (4036 bp)
Predicted protein sequence (1087 aa)
Flexi ORF Clone FXC01360
Description F-box protein, helicase, 18
Features of the cloned cDNA sequence

Length: 4036 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 237 bp
Genome contig ID gi89161187f_5881854
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATCTGGTCAGGGAAGTGGGGGATGTTCTTTTGAT
Flanking genome sequence
(137634 - 137683)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAATTTATGTATTTAAACTTTTATTACAAGATTTCA

Features of the protein sequence

Length: 1087 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8NFZ0 0 99.9 F-box only prot...
Homo sapiens
CAI41074 0 99.9 F-box protein, ...
Homo sapiens
AAP97705 0 99.8 testis protein ...
Homo sapiens
AAI13376 0 99.8 F-box protein, ...
Homo sapiens
BAC04535 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001810 254 302 PF00646 Cyclin-like F-box
ProfileScan IPR001810 253 302 PS50181 Cyclin-like F-box
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp