ORK01417

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01417

Order Kazusa clone(s) from :

Accession No	AB209526
Product ID	ORK01417
Clone name	fk09916
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HK1
cDNA sequence	DNA sequence (3595 bp) Predicted protein sequence (949 aa)
HaloTag ORF Clone	FHC01417
Flexi ORF Clone	FXC01417
Description	Hexokinase-1 (EC 2.7.1.1) (Hexokinase type I) (HK I) (Brain form hexokinase).

Features of the cloned cDNA sequence

Description

Length: 3595 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	744 bp
Genome contig ID	gi89161187f_70648613
PolyA signal sequence (AGTAAA,-20)	+--------+--------+----*----+---- CGTGTCGTATGACCTAGTAAACTTTGTACCAATTC
Flanking genome sequence (183030 - 183079)	----+--------+--------+--------+--------+----* AAAGACCCGAGTGATGCTTAATGGCTGGGGACGGGGGGACAGGCAGAGGG

Features of the protein sequence

Description

Length: 949 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92763	100.0	hexokinase 1 is...	Homo sapiens
EAW54323	99.6	hexokinase 1, i...	Homo sapiens
P19367	100.0	Hexokinase-1; H...	Homo sapiens
AAQ02439	100.0	hexokinase 1 [s...	synthetic construct
1HKC	99.8	D-GLUCOSE 6-PHO...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001312	307	442	PD001109	Hexokinase
BlastProDom	IPR001312	755	890	PD001109	Hexokinase
FPrintScan	IPR001312	561	577	PR00475	Hexokinase
	IPR001312	630	655	PR00475	Hexokinase
	IPR001312	683	699	PR00475	Hexokinase
	IPR001312	706	720	PR00475	Hexokinase
	IPR001312	771	793	PR00475	Hexokinase
	IPR001312	851	873	PR00475	Hexokinase
	IPR001312	923	939	PR00475	Hexokinase
HMMPfam	IPR001312	48	253	PF00349	Hexokinase
	IPR001312	255	494	PF03727	Hexokinase
	IPR001312	496	701	PF00349	Hexokinase
	IPR001312	703	942	PF03727	Hexokinase
ScanRegExp	IPR001312	182	207	PS00378	Hexokinase
ScanRegExp	IPR001312	630	655	PS00378	Hexokinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp