Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01420
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226150
Product ID ORK01420
Clone name fk11804
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol USP48
cDNA sequence DNA sequence (3630 bp)
Predicted protein sequence (1012 aa)
Flexi ORF Clone FXC01420
Description Ubiquitin carboxyl-terminal hydrolase 48 (EC 3.1.2.15) (Ubiquitin thioesterase 48) (Ubiquitin-specific-processing protease 48) (Deubiquitinating enzyme 48).
Features of the cloned cDNA sequence

Length: 3630 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 514 bp
Genome contig ID gi89161185r_21777983
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TCTACTTTCAATAAAGCATGAAAGTGAAGAACTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCTAAGTGTGGAAAAGTGTCTTCAGATTTAGACTCTTCTCCATGTCAGC

Features of the protein sequence

Length: 1012 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10829 0 100.0 ubiquitin carbo...
synthetic construct
NP_001027902 1.4e-201 100.0 ubiquitin carbo...
Homo sapiens
AAH67261 1.8e-201 89.2 USP48 protein [...
Homo sapiens
EAW94991 1.9e-201 90.6 ubiquitin speci...
Homo sapiens
XP_866736 1.9e-201 99.7 similar to ubiq...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001394 129 461 PF00443 Peptidase C19
ProfileScan IPR001394 132 465 PS50235 Peptidase C19
IPR000626 906 979 PS50053 Ubiquitin
ScanRegExp IPR001394 379 397 PS00973 Peptidase C19
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp