Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01432
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226074
Product ID ORK01432
Clone name sj01762
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COL1A2
cDNA sequence DNA sequence (4241 bp)
Predicted protein sequence (1369 aa)
Flexi ORF Clone FXC01432
Description Collagen alpha-2(I) chain precursor (Alpha-2 type I collagen).
Features of the cloned cDNA sequence

Length: 4241 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 18 bp
Genome contig ID gi89161213f_93762158
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
CAGTCTGTTTCAAATAAATGAACTCAATCTAAATT
Flanking genome sequence
(135503 - 135552)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAGAAATTTGAAAAAACTTTCTCTTTGCCATTTCTTCTTCTT

Features of the protein sequence

Length: 1369 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P08123 0 100.0 Collagen alpha-...
 Homo sapiens
NP_000080 0 99.9 collagen alpha-...
 Homo sapiens
XP_519207 0 99.8 alpha 2 type I ...
 Pan troglodytes
CAA98969 0 99.8 prepro-alpha2(I...
 Homo sapiens
AAB93981 0 99.4 pro-alpha 2(I) ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR008161 175 212 PD000007 Collagen helix repeat
IPR008161 438 464 PD000007 Collagen helix repeat
IPR008161 557 582 PD000007 Collagen helix repeat
IPR008161 829 849 PD000007 Collagen helix repeat
IPR008161 1009 1039 PD000007 Collagen helix repeat
IPR000885 1259 1368 PD002078 Fibrillar collagen
HMMPfam IPR008160 36 75 PF01391 Collagen triple helix repeat
IPR008160 93 150 PF01391 Collagen triple helix repeat
IPR008160 151 210 PF01391 Collagen triple helix repeat
IPR008160 211 270 PF01391 Collagen triple helix repeat
IPR008160 271 330 PF01391 Collagen triple helix repeat
IPR008160 331 390 PF01391 Collagen triple helix repeat
IPR008160 391 450 PF01391 Collagen triple helix repeat
IPR008160 472 531 PF01391 Collagen triple helix repeat
IPR008160 532 570 PF01391 Collagen triple helix repeat
IPR008160 571 630 PF01391 Collagen triple helix repeat
IPR008160 631 690 PF01391 Collagen triple helix repeat
IPR008160 694 753 PF01391 Collagen triple helix repeat
IPR008160 754 813 PF01391 Collagen triple helix repeat
IPR008160 814 873 PF01391 Collagen triple helix repeat
IPR008160 877 936 PF01391 Collagen triple helix repeat
IPR008160 937 993 PF01391 Collagen triple helix repeat
IPR008160 994 1053 PF01391 Collagen triple helix repeat
IPR008160 1054 1108 PF01391 Collagen triple helix repeat
IPR000885 1152 1368 PF01410 Fibrillar collagen
HMMSmart IPR000885 1135 1369 SM00038 Fibrillar collagen
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp