Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01456
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01456
Clone name bm01225
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol EIF3D
cDNA sequence DNA sequence (1855 bp)
Predicted protein sequence (570 aa)
Flexi ORF Clone FXC01456
Description Eukaryotic translation initiation factor 3 subunit 7 (eIF-3 zeta) (eIF3 p66) (eIF3d).
Features of the cloned cDNA sequence

Length: 1855 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 124 bp
Genome contig ID gi89161203r_35136856
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACATTTAGCAGATGAAATAAAATATATATCTGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCTTTCCCTCATCGTCTGCCTGCATTAACGATTTACAGTCGTTTCTTC

Features of the protein sequence

Length: 570 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15371 0 100.0 Eukaryotic tran...
Homo sapiens
Q5R925 0 99.8 Eukaryotic tran...
Pongo abelii
Q3T122 0 99.4 Eukaryotic tran...
Bos taurus
XP_850595 0 99.0 similar to euka...
Canis lupus fam...
XP_001158571 0 99.8 eukaryotic tran...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007783 23 562 PF05091 Eukaryotic translation initiation factor 3
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp