Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01465
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01465
Clone name ej00491
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLCB3
cDNA sequence DNA sequence (4177 bp)
Predicted protein sequence (1269 aa)
Flexi ORF Clone FXC01465
Description 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 3 (EC 3.1.4.11) (Phosphoinositide phospholipase C) (Phospholipase C- beta-3) (PLC-beta-3).
Features of the cloned cDNA sequence

Length: 4177 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 367 bp
Genome contig ID gi51511727f_63675593
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
GATTTTTTTTACATGAATAAAAGTGGATTTCAGGG
Flanking genome sequence
(116379 - 116428)		 
----+----*----+----*----+----*----+----*----+----*
ACCCTGTGTGCAGTGTGATTTGGGGTGACAGGACTCTGGGCCCTAAGTTT

Features of the protein sequence

Length: 1269 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q01970 0 100.0 1-phosphatidyli...
 Homo sapiens
CAA85776 0 97.5 phospholipase C...
 Homo sapiens
XP_001115104 0 96.3 similar to phos...
 Macaca mulatta
XP_853283 0 93.1 similar to phos...
 Canis lupus fam...
AAZ23846 0 92.8 phospholipase C...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013841 363 516 PD001202 Phosphatidylinositol-specific phospholipase C
IPR013841 562 737 PD001202 Phosphatidylinositol-specific phospholipase C
FPrintScan IPR001192 357 375 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 383 403 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 487 504 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 679 700 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 700 718 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 846 856 PR00390 Phosphoinositide-specific phospholipase C
HMMPfam IPR015359 260 351 PF09279 EF-hand-like
IPR000909 353 504 PF00388 Phosphatidylinositol-specific phospholipase C
IPR001711 624 741 PF00387 Phosphatidylinositol-specific phospholipase C
IPR000008 763 845 PF00168 C2 calcium-dependent membrane targeting
IPR014815 1058 1251 PF08703 PLC-beta
HMMSmart IPR000909 352 503 SM00148 Phosphatidylinositol-specific phospholipase C
IPR001711 625 741 SM00149 Phosphatidylinositol-specific phospholipase C
IPR000008 762 860 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR000909 353 503 PS50007 Phosphatidylinositol-specific phospholipase C
IPR001711 625 741 PS50008 Phosphatidylinositol-specific phospholipase C
IPR000008 748 845 PS50004 C2 calcium-dependent membrane targeting
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp