Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01483
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01483
Clone name bm00505
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ASH2L
cDNA sequence DNA sequence (2276 bp)
Predicted protein sequence (629 aa)
Flexi ORF Clone FXC01483
Description Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2-like protein).
Features of the cloned cDNA sequence

Length: 2276 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 384 bp
Genome contig ID gi51511724f_37982221
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAAGACATTTCCTTCTGTGGGCATTGACTGTAT
Flanking genome sequence
(133911 - 133960)
----+----*----+----*----+----*----+----*----+----*
CCCACCTGTTTTCCAAGGAAATGGTAACCTGTTTCTGAGAACACCTGAAA

Features of the protein sequence

Length: 629 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UBL3 0 100.0 Set1/Ash2 histo...
Homo sapiens
XP_001170172 0 99.6 ash2 (absent, s...
Pan troglodytes
BAF84439 0 99.6 unnamed protein...
Homo sapiens
AAC13564 0 99.2 ash2l1 [Homo sa...
Homo sapiens
XP_001492099 0 96.9 similar to ash2...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003877 419 521 PF00622 SPla/RYanodine receptor SPRY
HMMSmart IPR003877 419 583 SM00449 SPla/RYanodine receptor SPRY
ProfileScan IPR001870 361 584 PS50188 B302
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp