Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01488
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01488
Clone name bm01318
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MAGED2
cDNA sequence DNA sequence (2103 bp)
Predicted protein sequence (607 aa)
Flexi ORF Clone FXC01488
Description melanoma antigen family D, 2
Features of the cloned cDNA sequence

Length: 2103 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 195 bp
Genome contig ID gi89161218f_54752403
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAATTGACCCTTTTATTTTCTCTTACTTGTGTTTT
Flanking genome sequence
(106634 - 106683)
----+----*----+----*----+----*----+----*----+----*
CAGATATTGTTAATCCTGCCAGTCTTTCTCTTCAAGCCAGGGTGCATCCT

Features of the protein sequence

Length: 607 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UNF1 1.3e-195 100.0 Melanoma-associ...
Homo sapiens
AAD33392 2.8e-195 99.8 breast cancer a...
Homo sapiens
AAD00728 5.2e-195 99.8 hepatocellular ...
Homo sapiens
Q5RFC2 1.8e-193 99.1 Melanoma-associ...
Pongo abelii
XP_001091068 1.6e-192 98.8 melanoma antige...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002190 287 457 PF01454 MAGE protein
ProfileScan IPR002190 280 479 PS50838 MAGE protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp