ORK01490

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01490

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01490
Clone name	bm01867
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CCT7
cDNA sequence	DNA sequence (1821 bp) Predicted protein sequence (546 aa)
HaloTag ORF Clone	FHC01490
Flexi ORF Clone	FXC01490
Description	T-complex protein 1 subunit eta (TCP-1-eta) (CCT-eta) (HIV-1 Nef- interacting protein).

Features of the cloned cDNA sequence

Description

Length: 1821 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	143 bp
Genome contig ID	gi89161199f_73214969
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTACTGGAGGCTATTTAAATAAAATGTAAGACTTC
Flanking genome sequence (118673 - 118722)	----+--------+--------+--------+--------+----* AGATAACTTTGTAAATTATTTTGGCATGGTACTCATAAATGTCTGGCTGT

Features of the protein sequence

Description

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99832	100.0	T-complex prote...	Homo sapiens
XP_001104880	99.8	chaperonin cont...	Macaca mulatta
Q5R5C8	99.6	T-complex prote...	Pongo abelii
BAD96198	99.8	chaperonin cont...	Homo sapiens
CAG33000	99.6	CCT7 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	37	53	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	39	65	PR00298	Chaperonin Cpn60
	IPR002423	59	77	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	89	108	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	91	118	PR00298	Chaperonin Cpn60
	IPR002423	374	396	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	394	415	PR00298	Chaperonin Cpn60
	IPR002423	408	420	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	35	527	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012720	6	528	TIGR02345	T-complex protein 1
ScanRegExp	IPR002194	40	52	PS00750	Chaperonin TCP-1
	IPR002194	61	77	PS00751	Chaperonin TCP-1
	IPR002194	89	97	PS00995	Chaperonin TCP-1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp