ORK01494

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01494

Order Kazusa clone(s) from :

Accession No	AK226172
Product ID	ORK01494
Clone name	bm02342
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ZNF207
cDNA sequence	DNA sequence (2183 bp) Predicted protein sequence (497 aa)
HaloTag ORF Clone	FHC01494
Flexi ORF Clone	FXC01494
Description	Zinc finger protein 207.

Features of the cloned cDNA sequence

Description

Length: 2183 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	577 bp
Genome contig ID	gi51511734f_27601297
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- CTGTACTGTTAAACTTCATTGTAATAAAATGAGAG
Flanking genome sequence (120173 - 120222)	----+--------+--------+--------+--------+----* AAAAATTTATGCCTTTTTATTCATAACCCAGCTGTGGACCACTGCCTGAA

Features of the protein sequence

Description

Length: 497 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW80231	7.6e-129	100.0	zinc finger pro...	Homo sapiens
BAD92452	2.6e-128	100.0	zinc finger pro...	Homo sapiens
EDM05418	9e-128	99.1	rCG33491, isofo...	Rattus norvegicus
XP_001113013	1.2e-127	100.0	similar to zinc...	Macaca mulatta
Q5R8K4	1.4e-127	98.9	Zinc finger pro...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	142	154	PR01217	NULL
	NULL	157	173	PR01217	NULL
	NULL	210	231	PR01217	NULL
	NULL	231	247	PR01217	NULL
	NULL	255	272	PR01217	NULL
	NULL	330	355	PR01217	NULL
HMMSmart	IPR015880	14	37	SM00355	Zinc finger
HMMSmart	IPR015880	38	61	SM00355	Zinc finger
ScanRegExp	IPR007087	16	37	PS00028	Zinc finger
ScanRegExp	IPR007087	40	61	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp