Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01497
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209783
Product ID ORK01497
Clone name bm02581
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FASTK
cDNA sequence DNA sequence (1686 bp)
Predicted protein sequence (523 aa)
Flexi ORF Clone FXC01497
Description Fas-activated serine/threonine kinase (EC 2.7.11.8) (FAST kinase).
Features of the cloned cDNA sequence

Length: 1686 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 99 bp
Genome contig ID gi89161213r_150304646
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TGTGTTTTGATTTCTCATTAAAGTTCCTTTCCTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCCGTTGTGAATCTCAGTTTTGGGACGGGGAGCAGAGCTGAGTCCCCCGC

Features of the protein sequence

Length: 523 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93020 2.5e-210 100.0 Fas-activated s...
Homo sapiens
BAG10926 9.9e-210 100.0 Fas-activated s...
synthetic construct
XP_001139448 2e-209 99.8 Fas-activated s...
Pan troglodytes
XP_001103566 3e-205 97.8 Fas-activated s...
Macaca mulatta
XP_860611 2.8e-199 94.4 similar to Fas-...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010622 251 319 PF06743 FAST kinase leucine-rich
IPR013579 327 418 PF08368 FAST kinase-like protein
IPR013584 453 510 PF08373 RAP domain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp