ORK01500

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01500

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01500
Clone name	bm02770
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MAPK3
cDNA sequence	DNA sequence (1778 bp) Predicted protein sequence (380 aa)
HaloTag ORF Clone	FHC01500
Flexi ORF Clone	FXC01500
Description	Mitogen-activated protein kinase 3 (EC 2.7.11.24) (Extracellular signal-regulated kinase 1) (ERK-1) (Insulin-stimulated MAP2 kinase) (MAP kinase 1) (MAPK 1) (p44-ERK1) (ERT2) (p44-MAPK) (Microtubule- associated protein 2 kinase).

Features of the cloned cDNA sequence

Description

Length: 1778 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	635 bp
Genome contig ID	gi51511732r_29932928
PolyA signal sequence (TATAAA,-28)	+--------+--------+----*----+---- TCTAATATATAAATATAGAGATGTGTCTATGGCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGGCTCTGTCTGTGTTCGCGACGCCCCCGCCCTGCCCCGTGCGGCT

Features of the protein sequence

Description

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P27361	1.5e-153	100.0	Mitogen-activat...	Homo sapiens
AAQ02422	1.5e-153	100.0	mitogen-activat...	synthetic construct
CAA42744	4.8e-153	99.7	protein serine/...	Homo sapiens
AAA36142	3.8e-148	100.0	kinase 1 [Homo ...	Homo sapiens
ABK42191	5.2e-148	97.0	Erk1 [synthetic...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	49	248	PD000001	Protein kinase
BlastProDom	NULL	336	372	PD054205	NULL
FPrintScan	IPR008349	31	48	PR01770	ERK1/2 MAP kinase
	IPR008349	136	145	PR01770	ERK1/2 MAP kinase
	IPR008349	191	201	PR01770	ERK1/2 MAP kinase
	IPR008349	249	260	PR01770	ERK1/2 MAP kinase
	IPR008349	270	280	PR01770	ERK1/2 MAP kinase
	IPR008349	331	341	PR01770	ERK1/2 MAP kinase
HMMPfam	IPR000719	43	331	PF00069	Protein kinase
HMMSmart	IPR001245	43	331	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	43	331	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	43	331	PS50011	Protein kinase
ScanRegExp	IPR000719	49	73	PS00107	Protein kinase
	IPR003527	77	179	PS01351	MAP kinase
	IPR008271	163	175	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp