Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01511
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01511
Clone name bm03858
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SAE1
cDNA sequence DNA sequence (2005 bp)
Predicted protein sequence (354 aa)
Flexi ORF Clone FXC01511
Description SUMO1 activating enzyme subunit 1
Features of the cloned cDNA sequence

Length: 2005 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 939 bp
Genome contig ID gi42406306f_52226003
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTAAAGGAATGATAATAAAGTTACTTGCTTTAGG
Flanking genome sequence
(179286 - 179335)
----+----*----+----*----+----*----+----*----+----*
ATTTGCTTGTTTTTCTTCCACTTCAGAAGCTTCTGAGAGGGAATGGGATG

Features of the protein sequence

Length: 354 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UBE0 5e-148 100.0 SUMO-activating...
Homo sapiens
CAI29626 1.5e-147 99.7 hypothetical pr...
Pongo abelii
CAH93320 2.1e-147 99.7 hypothetical pr...
Pongo abelii
CAH92498 2.4e-147 99.4 hypothetical pr...
Pongo abelii
AAD12785 2.4e-147 99.7 SUMO-1-activati...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000011 48 72 PR01849 Ubiquitin-activating enzyme
IPR000011 164 191 PR01849 Ubiquitin-activating enzyme
HMMPfam IPR000594 43 174 PF00899 UBA/THIF-type NAD/FAD binding fold
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp