Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01524
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01524
Clone name bm05533
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol IKBKG
cDNA sequence DNA sequence (1969 bp)
Predicted protein sequence (425 aa)
Flexi ORF Clone FXC01524
Description NF-kappa-B essential modulator (NEMO) (NF-kappa-B essential modifier) (Inhibitor of nuclear factor kappa-B kinase subunit gamma) (IkB kinase subunit gamma) (I-kappa-B kinase gamma) (IKK-gamma) (IKKG) (IkB kinase-associated protein 1) (IKKAP1) (FIP-3).
Features of the cloned cDNA sequence

Length: 1969 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 584 bp
Genome contig ID gi89161218f_153329045
PolyA signal sequence
(AGTAAA,-20)
+----*----+----*----+----*----+----
CATAAATAATGGCATAGTAAAAATCCTTGTGCATT
Flanking genome sequence
(117411 - 117460)
----+----*----+----*----+----*----+----*----+----*
AGTCGTGCGTATCTTTGGCATAGATTCTGAGAAGTGACACCACTGAGCAT

Features of the protein sequence

Length: 425 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAM44073 2.3e-122 100.0 inhibitor of ka...
Homo sapiens
Q9Y6K9 6.3e-120 100.0 NF-kappa-B esse...
Homo sapiens
AAD12183 2.3e-119 99.5 leucine zipper ...
Homo sapiens
ABX10999 1e-118 98.8 inhibitor of ka...
Papio anubis
ABZ10499 6.8e-115 96.1 inhibitor of ka...
Callithrix jacchus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp