Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01526
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209843
Product ID ORK01526
Clone name ef00749
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PSMD2
cDNA sequence DNA sequence (2900 bp)
Predicted protein sequence (913 aa)
Flexi ORF Clone FXC01526
Description 26S proteasome non-ATPase regulatory subunit 2 (26S proteasome regulatory subunit RPN1) (26S proteasome regulatory subunit S2) (26S proteasome subunit p97) (Tumor necrosis factor type 1 receptor- associated protein 2) (55.11 protein).
Features of the cloned cDNA sequence

Length: 2900 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 158 bp
Genome contig ID gi89161205f_185399734
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TGAGATAAGGTTGTTCAATAAAGACTTTTATCCCC
Flanking genome sequence
(109798 - 109847)		 
----+----*----+----*----+----*----+----*----+----*
AAGGTCTCTCTGTGTCTGTTTTCTGGGGTGTCATGGCTGGAGTCTAAACT

Features of the protein sequence

Length: 913 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93080 0 100.0 proteasome 26S ...
 Homo sapiens
XP_001147528 0 99.8 proteasome 26S ...
 Pan troglodytes
BAG10963 0 100.0 26S proteasome ...
 synthetic construct
XP_001147451 0 99.7 proteasome 26S ...
 Pan troglodytes
Q13200 0 99.8 26S proteasome ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002015 414 447 PF01851 Proteasome/cyclosome
IPR002015 448 484 PF01851 Proteasome/cyclosome
IPR002015 485 519 PF01851 Proteasome/cyclosome
IPR002015 522 556 PF01851 Proteasome/cyclosome
IPR002015 694 728 PF01851 Proteasome/cyclosome
IPR002015 729 763 PF01851 Proteasome/cyclosome
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp