ORK01549

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01549

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01549
Clone name	ej00480
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MCL1
cDNA sequence	DNA sequence (3923 bp) Predicted protein sequence (367 aa)
HaloTag ORF Clone	FHC01549
Flexi ORF Clone	FXC01549
Description	Induced myeloid leukemia cell differentiation protein Mcl-1 (Bcl-2- related protein EAT/mcl1) (mcl1/EAT).

Features of the cloned cDNA sequence

Description

Length: 3923 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2818 bp
Genome contig ID	gi89161185r_148713684
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GTTTTTCCTGAGAAAAAAAAATAAATCTTTTATTC
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* AAATACAGGGTGTGATATGGGTCTTTTCTCATCGACGCCTCTTTTTCCTT

Features of the protein sequence

Description

Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q07820	1.2e-118	100.0	Induced myeloid...	Homo sapiens
AAP36208	1.2e-118	100.0	myeloid cell le...	synthetic construct
AAF64255	1.9e-118	99.7	Mcl-1 [Homo sap...	Homo sapiens
BAG35409	2.2e-118	99.7	unnamed protein...	Homo sapiens
XP_513776	3.6e-116	98.2	myeloid cell le...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013281	253	269	PR01866	Apoptosis regulator
	IPR000712	263	275	PR01862	Apoptosis regulator Bcl-2
	IPR013281	270	283	PR01866	Apoptosis regulator
	IPR000712	277	305	PR01862	Apoptosis regulator Bcl-2
	IPR013281	285	300	PR01866	Apoptosis regulator
	IPR000712	306	330	PR01862	Apoptosis regulator Bcl-2
	IPR013281	339	352	PR01866	Apoptosis regulator
	IPR013281	354	367	PR01866	Apoptosis regulator
HMMPfam	IPR000712	230	329	PF00452	Apoptosis regulator Bcl-2
HMMSmart	IPR000712	230	329	SM00337	Apoptosis regulator Bcl-2
ProfileScan	IPR002475	230	331	PS50062	BCL2-like apoptosis inhibitor
ScanRegExp	IPR000712	226	240	PS01259	Apoptosis regulator Bcl-2
	IPR000712	270	289	PS01080	Apoptosis regulator Bcl-2
	IPR000712	322	333	PS01258	Apoptosis regulator Bcl-2

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	276	TNWGRIVTLISFGAFVAKHLKTI	298	SECONDARY	23
SOSUI2	2	344	GIRNVLLAFAGVAGVGAGLAYLI	366	PRIMARY	23