Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01553
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01553
Clone name ej00937
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TRIB1
cDNA sequence DNA sequence (3544 bp)
Predicted protein sequence (382 aa)
Flexi ORF Clone FXC01553
Description Tribbles homolog 1 (TRB-1) (SKIP1) (G-protein-coupled receptor-induced protein 2) (GIG-2).
Features of the cloned cDNA sequence

Length: 3544 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1933 bp
Genome contig ID gi51511724f_126411835
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTAGAGAAATTTTAATAAACCTGGTTTCGTAAAT
Flanking genome sequence
(107995 - 108044)
----+----*----+----*----+----*----+----*----+----*
AGGTGTGGTGAATTTCTTTCGAGTTCCATCTGCTTTGCCTTTTGCAATTT

Features of the protein sequence

Length: 382 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96RU8 1.7e-122 100.0 Tribbles homolo...
Homo sapiens
AAK58174 4.4e-122 99.7 SKIP1 [Homo sap...
Homo sapiens
XP_519955 4.4e-122 99.4 G-protein-coupl...
Pan troglodytes
XP_001082540 1.1e-121 98.9 similar to G-pr...
Macaca mulatta
XP_001082164 2.8e-120 97.8 similar to G-pr...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 175 348 PD000001 Protein kinase
HMMPfam IPR000719 256 348 PF00069 Protein kinase
HMMSmart IPR002290 114 348 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 101 348 PS50011 Protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp