ORK01564

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01564

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01564
Clone name	ek00353
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CTNNA1
cDNA sequence	DNA sequence (3425 bp) Predicted protein sequence (932 aa)
HaloTag ORF Clone	FHC01564
Flexi ORF Clone	FXC01564
Description	Catenin alpha-1 (Cadherin-associated protein) (Alpha E-catenin) (NY- REN-13 antigen).

Features of the cloned cDNA sequence

Description

Length: 3425 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	625 bp
Genome contig ID	gi51511721f_138017022
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCTGCAGGACATTAATAAAGTTGCTTTTTTAGGCT
Flanking genome sequence (281279 - 281328)	----+--------+--------+--------+--------+----* ACAGTGTCTCGATGCCATAATCAGAACACACTTTTTTTCCTCTTTCTCCC

Features of the protein sequence

Description

Length: 932 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P35221	100.0	Catenin alpha-1...	Homo sapiens
XP_001172018	99.8	catenin, alpha ...	Pan troglodytes
BAA03530	99.7	alpha-catenin [...	Homo sapiens
P26231	99.4	Catenin alpha-1...	Mus musculus
XP_001504306	99.6	similar to Cate...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001033	38	62	PR00805	Alpha-catenin
	IPR001033	136	154	PR00805	Alpha-catenin
	IPR001033	155	173	PR00805	Alpha-catenin
	IPR001033	331	355	PR00805	Alpha-catenin
	IPR001033	399	419	PR00805	Alpha-catenin
	IPR001033	520	544	PR00805	Alpha-catenin
	IPR001033	635	659	PR00805	Alpha-catenin
	IPR006077	736	753	PR00806	Vinculin/alpha-catenin
	IPR001033	737	759	PR00805	Alpha-catenin
	IPR006077	773	788	PR00806	Vinculin/alpha-catenin
	IPR006077	788	803	PR00806	Vinculin/alpha-catenin
	IPR001033	801	825	PR00805	Alpha-catenin
	IPR006077	807	828	PR00806	Vinculin/alpha-catenin
	IPR006077	844	863	PR00806	Vinculin/alpha-catenin
	IPR001033	881	899	PR00805	Alpha-catenin
HMMPfam	IPR006077	45	893	PF01044	Vinculin/alpha-catenin
ScanRegExp	IPR000633	204	224	PS00663	Vinculin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp