Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01576
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01576
Clone name hk07193
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TADA2A
cDNA sequence DNA sequence (3614 bp)
Predicted protein sequence (444 aa)
Flexi ORF Clone FXC01576
Description Transcriptional adapter 2-like (ADA2-like protein).
Features of the cloned cDNA sequence

Length: 3614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2279 bp
Genome contig ID gi51511734f_32757722
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTAAGTGGTGGGAAATAAAGAACAAATCTCTTTCC
Flanking genome sequence
(156222 - 156271)
----+----*----+----*----+----*----+----*----+----*
ATGTAATGACTCTTCTCTGTGCTCAAAGACCAAGACTCTGTCTCTTGCGA

Features of the protein sequence

Length: 444 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75478 7.9e-189 100.0 Transcriptional...
Homo sapiens
NP_001479 2e-188 99.7 transcriptional...
Homo sapiens
BAG51111 2e-188 99.7 unnamed protein...
Homo sapiens
EAW57588 2.7e-188 100.0 transcriptional...
Homo sapiens
XP_001503890 6.5e-188 99.5 similar to Tran...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014778 73 119 PF00249 Myb
IPR007526 357 443 PF04433 SWIRM
HMMSmart IPR001005 72 121 SM00717 SANT
ProfileScan IPR001005 75 119 PS50090 SANT
IPR007526 357 444 PS50934 SWIRM
ScanRegExp IPR001005 76 84 PS00037 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp