ORK01577

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01577

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01577
Clone name	fh12075
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRNT1
cDNA sequence	DNA sequence (5668 bp) Predicted protein sequence (438 aa)
HaloTag ORF Clone	FHC01577
Flexi ORF Clone	FXC01577
Description	tRNA-nucleotidyltransferase 1, mitochondrial precursor (EC 2.7.7.25) (Mitochondrial tRNA nucleotidyl transferase, CCA-adding) (mt tRNA adenylyltransferase) (mt tRNA CCA-pyrophosphorylase) (mt tRNA CCA- diphosphorylase) (mt CCA-adding enzyme).

Features of the cloned cDNA sequence

Description

Length: 5668 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4297 bp
Genome contig ID	gi89161205f_3043636
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTTAGGACTCTGGATTTTTCTGCCCAATTAAGGT
Flanking genome sequence (125465 - 125514)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAAAAAAGCAACCACCACCATAATATTACCCAGGAAACC

Features of the protein sequence

Description

Length: 438 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96Q11	5e-184	100.0	tRNA-nucleotidy...	Homo sapiens
XP_001140761	1.5e-183	99.5	tRNA nucleotidy...	Pan troglodytes
XP_001100764	4.3e-180	97.6	tRNA nucleotidy...	Macaca mulatta
XP_001496927	5.1e-174	94.9	tRNA nucleotidy...	Equus caballus
EDK99397	2.4e-171	92.8	tRNA nucleotidy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002646	63	186	PF01743	Polynucleotide adenylyltransferase region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp