Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01579
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01579
Clone name fj22623
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NRIP1
cDNA sequence DNA sequence (4770 bp)
Predicted protein sequence (1163 aa)
Flexi ORF Clone FXC01579
Description Nuclear receptor-interacting protein 1 (Nuclear factor RIP140) (Receptor-interacting protein 140).
Features of the cloned cDNA sequence

Length: 4770 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 526 bp
Genome contig ID gi51511750r_15158382
PolyA signal sequence
(AATATA,-29)
+----*----+----*----+----*----+----
TAGAAAAATATATGCTTACATTTTTCACTTTTGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAAAAAAAGGTGTTTATTTTTAACTCTTGGAAGAGGTTTTGT

Features of the protein sequence

Length: 1163 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11049 0 100.0 nuclear recepto...
synthetic construct
P48552 0 99.9 Nuclear recepto...
Homo sapiens
AAH40361 0 99.8 Nuclear recepto...
Homo sapiens
AAX36184 0 99.8 nuclear recepto...
synthetic construct
ABM85288 0 99.7 nuclear recepto...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp