Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01643
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290175
Product ID ORK01643
Clone name ef06286
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MYH9
cDNA sequence DNA sequence (7345 bp)
Predicted protein sequence (1962 aa)
Flexi ORF Clone FXC01643
Description Myosin-9 (Myosin heavy chain 9) (Myosin heavy chain, nonmuscle IIa) (Nonmuscle myosin heavy chain IIa) (NMMHC II-a) (NMMHC-IIA) (Cellular myosin heavy chain, type A) (Nonmuscle myosin heavy chain-A) (NMMHC- A).
Features of the cloned cDNA sequence

Length: 7345 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1389 bp
Genome contig ID gi89161203r_34907270
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
ACTGAGCATCACAATAAAGAGAACCATGTGCTACG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGCCGTGTCTGTAGCATTTGTCTGCGGCCAGGGGGCCCTGGACAGGACTA

Features of the protein sequence

Length: 1962 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P35579 0 100.0 Myosin-9; Myosi...
 Homo sapiens
Q258K2 0 98.2 Myosin-9; Myosi...
 Canis lupus fam...
XP_612582 0 97.1 hypothetical pr...
 Bos taurus
BAE27768 0 97.0 unnamed protein...
 Mus musculus
BAE27761 0 97.0 unnamed protein...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 210 245 PD000355 Myosin head
NULL 1507 1678 PD023692 NULL
FPrintScan IPR001609 113 132 PR00193 Myosin head
IPR001609 169 194 PR00193 Myosin head
IPR001609 218 245 PR00193 Myosin head
IPR001609 449 477 PR00193 Myosin head
IPR001609 503 531 PR00193 Myosin head
HMMPfam IPR004009 31 73 PF02736 Myosin
IPR001609 85 766 PF00063 Myosin head
IPR000048 782 802 PF00612 IQ calmodulin-binding region
IPR002928 1068 1925 PF01576 Myosin tail
HMMSmart IPR001609 77 779 SM00242 Myosin head
IPR000048 780 802 SM00015 IQ calmodulin-binding region
ProfileScan IPR000048 781 810 PS50096 IQ calmodulin-binding region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp