Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01646
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210028
Product ID ORK01646
Clone name hh03521
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLCG1
cDNA sequence DNA sequence (5490 bp)
Predicted protein sequence (1412 aa)
Flexi ORF Clone FXC01646
Description 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (EC 3.1.4.11) (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148).
Features of the cloned cDNA sequence

Length: 5490 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1212 bp
Genome contig ID gi51511747f_39099291
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
TGACTGCCAAATAAATCATCCTCATGTCCTTTTTC
Flanking genome sequence
(138486 - 138535)		 
----+----*----+----*----+----*----+----*----+----*
CTTTGACTTGTATGCTCTTTCGGGGGCTCAGGAAAGCCTGTTGCATGGGA

Features of the protein sequence

Length: 1412 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06110 0 100.0 PLCG1 variant p...
 Homo sapiens
XP_514650 0 99.5 phospholipase C...
 Pan troglodytes
BAG10236 0 100.0 phospholipase C...
 synthetic construct
P19174 0 99.9 1-phosphatidyli...
 Homo sapiens
ABB84466 0 99.9 phospholipase C...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013841 453 649 PD001202 Phosphatidylinositol-specific phospholipase C
IPR000980 672 766 PD000093 SH2 motif
IPR000980 790 877 PD000093 SH2 motif
IPR001452 918 969 PD000066 Src homology-3
IPR013841 1061 1198 PD001202 Phosphatidylinositol-specific phospholipase C
FPrintScan IPR001192 447 465 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 473 493 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 570 587 PR00390 Phosphoinositide-specific phospholipase C
IPR000980 790 804 PR00401 SH2 motif
IPR000980 810 820 PR00401 SH2 motif
IPR000980 821 832 PR00401 SH2 motif
IPR000980 833 843 PR00401 SH2 motif
IPR000980 852 866 PR00401 SH2 motif
IPR001452 916 926 PR00452 Src homology-3
IPR001452 930 945 PR00452 Src homology-3
IPR001452 947 956 PR00452 Src homology-3
IPR001452 959 971 PR00452 Src homology-3
IPR001192 1130 1151 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 1151 1169 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 1300 1310 PR00390 Phosphoinositide-specific phospholipase C
HMMPfam IPR001849 155 264 PF00169 Pleckstrin-like
IPR000909 443 587 PF00388 Phosphatidylinositol-specific phospholipase C
IPR000980 672 761 PF00017 SH2 motif
IPR000980 790 863 PF00017 SH2 motif
IPR001452 916 971 PF00018 Src homology-3
IPR001711 1074 1192 PF00387 Phosphatidylinositol-specific phospholipase C
IPR000008 1212 1299 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR001849 155 266 SM00233 Pleckstrin-like
IPR000909 442 586 SM00148 Phosphatidylinositol-specific phospholipase C
IPR001849 611 802 SM00233 Pleckstrin-like
IPR000980 670 767 SM00252 SH2 motif
IPR000980 788 869 SM00252 SH2 motif
IPR001452 916 972 SM00326 Src homology-3
IPR001849 926 1055 SM00233 Pleckstrin-like
IPR001711 1075 1192 SM00149 Phosphatidylinositol-specific phospholipase C
IPR000008 1211 1314 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR001849 149 264 PS50003 Pleckstrin-like
IPR002048 274 309 PS50222 Calcium-binding EF-hand
IPR000909 442 586 PS50007 Phosphatidylinositol-specific phospholipase C
IPR000980 672 779 PS50001 SH2 motif
IPR000980 790 878 PS50001 SH2 motif
IPR001452 913 973 PS50002 Src homology-3
IPR001849 1017 1053 PS50003 Pleckstrin-like
IPR001711 1075 1192 PS50008 Phosphatidylinositol-specific phospholipase C
IPR000008 1197 1299 PS50004 C2 calcium-dependent membrane targeting
ScanRegExp IPR002048 287 299 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp