ORK01679

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01679

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01679
Clone name	hj06379s3
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGCGGACGCG TGGG-5' end of cDNA. This cDNA clone hj06379s3 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	TRIM33
cDNA sequence	DNA sequence (3424 bp) Predicted protein sequence (1131 aa)
HaloTag ORF Clone	FHC01679
Flexi ORF Clone	FXC01679
Description	tripartite motif-containing 33

Features of the cloned cDNA sequence

Description

Length: 3424 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	27 bp
Genome contig ID	gi89161185r_114641766
PolyA signal sequence (AGTAAA,-32)	+--------+--------+----*----+---- TAAAGTAAAATGACATGGATTTAAATCAATTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACGAAAAAAAAAAAAAAAACACAAAAAACCCAGAAAAC

Features of the protein sequence

Description

Length: 1131 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPN9	100.0	E3 ubiquitin-pr...	Homo sapiens
CAI13550	99.9	tripartite moti...	Homo sapiens
AAD17259	99.6	transcriptional...	Homo sapiens
XP_612660	97.6	similar to trip...	Bos taurus
CAB55313	99.5	rfg7 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	289	306	PR01406	Zinc finger
	IPR000315	307	321	PR01406	Zinc finger
	IPR001487	994	1010	PR00503	Bromodomain
	IPR001487	1013	1031	PR00503	Bromodomain
	IPR001487	1031	1050	PR00503	Bromodomain
HMMPfam	IPR000315	216	263	PF00643	Zinc finger
	IPR000315	275	316	PF00643	Zinc finger
	IPR001965	893	938	PF00628	Zinc finger
	IPR001487	966	1055	PF00439	Bromodomain
HMMSmart	IPR001965	128	189	SM00249	Zinc finger
	IPR001841	129	188	SM00184	Zinc finger
	IPR000315	216	263	SM00336	Zinc finger
	IPR001841	221	283	SM00184	Zinc finger
	IPR000315	275	316	SM00336	Zinc finger
	IPR003649	323	449	SM00502	B-box
	IPR001965	893	936	SM00249	Zinc finger
	IPR001487	963	1086	SM00297	Bromodomain
ProfileScan	IPR001841	129	189	PS50089	Zinc finger
	IPR000315	216	263	PS50119	Zinc finger
	IPR000315	275	316	PS50119	Zinc finger
	IPR001965	891	938	PS50016	Zinc finger
	IPR001487	978	1050	PS50014	Bromodomain
ScanRegExp	IPR001841	149	158	PS00518	Zinc finger
ScanRegExp	IPR001965	894	935	PS01359	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp