ORK01680

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01680

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01680
Clone name	fh02484
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NXPH3
cDNA sequence	DNA sequence (5429 bp) Predicted protein sequence (306 aa)
HaloTag ORF Clone	FHC01680
Flexi ORF Clone	FXC01680
Description	Neurexophilin-3 precursor.

Features of the cloned cDNA sequence

Description

Length: 5429 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4507 bp
Genome contig ID	gi51511734f_44908418
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GCGTATTGTTAGGAAAATTAAATGAGTTGCTCAAT
Flanking genome sequence (107752 - 107801)	----+--------+--------+--------+--------+----* AAATGTTACTTCCTCCTGTCTTTTTTTTTCTAAGATGGGTTGTTGTTAAC

Features of the protein sequence

Description

Length: 306 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95157	3.1e-99	100.0	Neurexophilin-3...	Homo sapiens
AAH22541	1.1e-98	99.6	Neurexophilin 3...	Homo sapiens
XP_001093691	4.2e-98	98.4	similar to Neur...	Macaca mulatta
XP_851450	5.2e-96	97.2	similar to Neur...	Canis lupus fam...
Q91VX5	9.1e-96	96.4	Neurexophilin-3...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010450	56	306	PF06312	Neurexophilin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp