ORK01683

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01683

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01683
Clone name	hh11961s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGCCCACGCG TCCG-5' end of cDNA.
Symbol	BRPF3
cDNA sequence	DNA sequence (6018 bp) Predicted protein sequence (1214 aa)
HaloTag ORF Clone	FHC01683
Flexi ORF Clone	FXC01683
Description	bromodomain and PHD finger containing, 3

Features of the cloned cDNA sequence

Description

Length: 6018 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2176 bp
Genome contig ID	gi89161210f_36172590
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTTTCTCTCTGAGAAATAAATGTTCTAATGGGC
Flanking genome sequence (135953 - 136002)	----+--------+--------+--------+--------+----* AGTAGTTGCTGTGTTGTGTTTAATCAGTAGGGGCCTACCCCTGTCTTCCC

Features of the protein sequence

Description

Length: 1214 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10446	100.0	bromodomain and...	synthetic construct
Q9ULD4	99.9	Bromodomain and...	Homo sapiens
EAX03880	99.6	bromodomain and...	Homo sapiens
XP_518433	99.5	bromodomain and...	Pan troglodytes
XP_538883	95.8	similar to Brom...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	632	648	PR00503	Bromodomain
	IPR001487	648	666	PR00503	Bromodomain
	IPR001487	666	685	PR00503	Bromodomain
HMMPfam	IPR001965	223	271	PF00628	Zinc finger
	IPR001487	603	690	PF00439	Bromodomain
	IPR000313	1082	1182	PF00855	PWWP
HMMSmart	IPR001965	223	269	SM00249	Zinc finger
	IPR001965	333	396	SM00249	Zinc finger
	IPR001487	596	704	SM00297	Bromodomain
	IPR000313	1083	1166	SM00293	PWWP
ProfileScan	IPR001965	221	271	PS50016	Zinc finger
	IPR001487	615	685	PS50014	Bromodomain
	IPR000313	1085	1168	PS50812	PWWP
ScanRegExp	IPR001965	224	268	PS01359	Zinc finger
ScanRegExp	IPR001487	620	677	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp