Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01687
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01687
Clone name ek00387
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PDCD6IP
cDNA sequence DNA sequence (3189 bp)
Predicted protein sequence (902 aa)
Flexi ORF Clone FXC01687
Description Programmed cell death 6-interacting protein (PDCD6-interacting protein) (ALG-2-interacting protein 1) (Hp95).
Features of the cloned cDNA sequence

Length: 3189 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 480 bp
Genome contig ID gi89161205f_33715123
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAATCTTATAATTTTAAAATAAATTACTTAAGAAC
Flanking genome sequence
(168380 - 168429)
----+----*----+----*----+----*----+----*----+----*
AGTTGTCATTGTTATGTTTTGTTATTGATTCTCATTACTGTCTAATTTTT

Features of the protein sequence

Length: 902 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8WUM4 5.3e-208 100.0 Programmed cell...
Homo sapiens
XP_001169526 8.3e-208 99.8 programmed cell...
Pan troglodytes
AAK20398 9e-208 99.8 HP95 [Homo sapi...
Homo sapiens
AAF08220 1.7e-207 99.7 ALG-2 interacti...
Homo sapiens
XP_001169543 3.3e-207 99.5 programmed cell...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan NULL 751 767 PR01217 NULL
NULL 771 783 PR01217 NULL
NULL 783 804 PR01217 NULL
NULL 814 830 PR01217 NULL
NULL 840 857 PR01217 NULL
NULL 875 900 PR01217 NULL
HMMPfam IPR004328 37 416 PF03097 BRO1
ProfileScan IPR004328 37 426 PS51180 BRO1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp