ORK01692

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01692

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01692
Clone name	hk03643
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNAH2
cDNA sequence	DNA sequence (4119 bp) Predicted protein sequence (827 aa)
HaloTag ORF Clone	FHC01692
Flexi ORF Clone	FXC01692
Description	dynein heavy chain domain 3

Features of the cloned cDNA sequence

Description

Length: 4119 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	286 bp
Genome contig ID	gi51511734f_7461397
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TCAATTAACTAATTTATTAAAAATATATAGTGAGC
Flanking genome sequence (126548 - 126597)	----+--------+--------+--------+--------+----* ACCTTCCATGTGTCAGGAACTGAAATAGGAACAGGCAGGGAATGTACACA

Features of the protein sequence

Description

Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11332	100.0	dynein heavy ch...	synthetic construct
EAW90129	99.7	dynein heavy ch...	Homo sapiens
EAW90130	98.5	dynein heavy ch...	Homo sapiens
EAW90131	100.0	dynein heavy ch...	Homo sapiens
Q9P225	100.0	Dynein heavy ch...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	275	744	PF08385	Dynein heavy chain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp