ORK01726

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01726

Order Kazusa clone(s) from :

Accession No	AK226055
Product ID	ORK01726
Clone name	fk08334
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LRRN2
cDNA sequence	DNA sequence (3086 bp) Predicted protein sequence (738 aa)
HaloTag ORF Clone	FHC01726
Flexi ORF Clone	FXC01726
Description	Leucine-rich repeat neuronal protein 5 precursor (Glioma amplified on chromosome 1 protein).

Features of the cloned cDNA sequence

Description

Length: 3086 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	679 bp
Genome contig ID	gi89161185r_202752979
PolyA signal sequence (None)	+--------+--------+----*----+---- AACAATAATACGGGGGAAAGGAACGAAAGGAAAAT
Flanking genome sequence (99944 - 99895)	----+--------+--------+--------+--------+----* AATCCTCTGAGTATTGAGTGTGGTTAAGGAGCTCTGCTCTGGACTCTCCT

Features of the protein sequence

Description

Length: 738 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAQ88657	100.0	GAC1 [Homo sapi...	Homo sapiens
O75325	99.8	Leucine-rich re...	Homo sapiens
AAH34047	99.5	Leucine rich re...	Homo sapiens
AAC39792	99.7	glioma amplifie...	Homo sapiens
XP_001160204	98.7	similar to GAC1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	120	133	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	165	178	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	119	141	PF00560	Leucine-rich repeat
	IPR001611	143	165	PF00560	Leucine-rich repeat
	IPR001611	167	189	PF00560	Leucine-rich repeat
	IPR001611	191	213	PF00560	Leucine-rich repeat
	IPR001611	239	261	PF00560	Leucine-rich repeat
	IPR001611	263	285	PF00560	Leucine-rich repeat
	IPR001611	287	309	PF00560	Leucine-rich repeat
	IPR001611	336	359	PF00560	Leucine-rich repeat
	IPR000483	419	446	PF01463	Cysteine-rich flanking region
	IPR013098	451	539	PF07679	Immunoglobulin I-set
HMMSmart	NULL	117	138	SM00365	NULL
	IPR003591	117	140	SM00369	Leucine-rich repeat
	IPR003591	141	164	SM00369	Leucine-rich repeat
	IPR003591	165	188	SM00369	Leucine-rich repeat
	NULL	165	191	SM00365	NULL
	IPR003591	189	212	SM00369	Leucine-rich repeat
	IPR003591	213	236	SM00369	Leucine-rich repeat
	IPR003591	237	260	SM00369	Leucine-rich repeat
	IPR003591	261	284	SM00369	Leucine-rich repeat
	NULL	261	287	SM00365	NULL
	IPR003591	285	308	SM00369	Leucine-rich repeat
	IPR003591	334	358	SM00369	Leucine-rich repeat
	IPR003591	359	382	SM00369	Leucine-rich repeat
	IPR000483	394	446	SM00082	Cysteine-rich flanking region
	IPR003599	455	540	SM00409	Immunoglobulin subtype
	IPR003598	461	529	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	447	536	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	25	TMRLLVAPLLLAWVAGATATVPV	47	PRIMARY	23
SOSUI2	2	84	FLTAVPPALPAGTQTLLLQSNSI	106	SECONDARY	23