Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01727
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01727
Clone name ha00950
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol CAD
cDNA sequence DNA sequence (6900 bp)
Predicted protein sequence (2196 aa)
Flexi ORF Clone FXC01727
Description carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Features of the cloned cDNA sequence

Length: 6900 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 267 bp
Genome contig ID gi89161199f_27193780
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TCTACTGACTTAATAAACAGCCGAGCTGTCCCTTG
Flanking genome sequence
(126379 - 126428)
----+----*----+----*----+----*----+----*----+----*
ATGCTGAGTGTAGTAGAACAGAGCTTTCTTTTAGAAAATTGAGCAGATTC

Features of the protein sequence

Length: 2196 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10624 0 100.0 CAD protein [sy...
synthetic construct
AAY24293 0 97.0 unknown [Homo s...
Homo sapiens
P27708 0 97.1 CAD protein; In...
Homo sapiens
XP_001155357 0 97.0 carbamoylphosph...
Pan troglodytes
BAA11423 0 96.8 multifunctional...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001317 212 226 PR00099 Carbamoyl-phosphate synthase
IPR001317 248 262 PR00099 Carbamoyl-phosphate synthase
IPR006220 251 260 PR00097 Anthranilate synthase component II/delta crystallin
IPR011702 251 260 PR00096 Glutamine amidotransferase superfamily
IPR006220 281 292 PR00097 Anthranilate synthase component II/delta crystallin
IPR011702 281 292 PR00096 Glutamine amidotransferase superfamily
IPR001317 281 297 PR00099 Carbamoyl-phosphate synthase
IPR001317 298 315 PR00099 Carbamoyl-phosphate synthase
IPR001317 323 334 PR00099 Carbamoyl-phosphate synthase
IPR006220 366 379 PR00097 Anthranilate synthase component II/delta crystallin
IPR011702 366 379 PR00096 Glutamine amidotransferase superfamily
IPR005483 915 929 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 944 954 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 1058 1070 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 1094 1113 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 1128 1145 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 1183 1212 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 1255 1273 PR00098 Carbamoyl-phosphate synthetase large chain
IPR002082 1930 1952 PR00101 Aspartate carbamoyltransferase
IPR006130 1940 1959 PR00100 Aspartate/ornithine carbamoyltransferase
IPR002082 1968 1977 PR00101 Aspartate carbamoyltransferase
IPR002082 2022 2039 PR00101 Aspartate carbamoyltransferase
IPR006130 2023 2034 PR00100 Aspartate/ornithine carbamoyltransferase
IPR002082 2113 2122 PR00101 Aspartate carbamoyltransferase
IPR006130 2148 2157 PR00100 Aspartate/ornithine carbamoyltransferase
IPR002082 2152 2157 PR00101 Aspartate carbamoyltransferase
IPR006130 2158 2181 PR00100 Aspartate/ornithine carbamoyltransferase
IPR002082 2174 2188 PR00101 Aspartate carbamoyltransferase
HMMPfam IPR002474 34 193 PF00988 Carbamoyl-phosphate synthase
IPR000991 213 390 PF00117 Glutamine amidotransferase class-I
IPR005481 426 546 PF00289 Carbamoyl-phosphate synthetase large chain
IPR005479 548 648 PF02786 Carbamoyl-phosphate synthase L chain
IPR005479 649 716 PF02786 Carbamoyl-phosphate synthase L chain
IPR005480 769 892 PF02787 Carbamoyl-phosphate synthetase large chain
IPR005481 902 1016 PF00289 Carbamoyl-phosphate synthetase large chain
IPR005479 1018 1239 PF02786 Carbamoyl-phosphate synthase L chain
IPR011607 1298 1399 PF02142 MGS-like
IPR006680 1433 1718 PF01979 Amidohydrolase 1
IPR006132 1895 2037 PF02729 Aspartate/ornithine carbamoyltransferase
IPR006131 2041 2192 PF00185 Aspartate/ornithine carbamoyltransferase
HMMTigr IPR006274 36 393 TIGR01368 Carbamoyl-phosphate synthase
IPR006275 422 1411 TIGR01369 Carbamoyl-phosphate synthase
IPR004722 1396 1768 TIGR00857 Dihydroorotase multifunctional complex type
IPR002082 1895 2194 TIGR00670 Aspartate carbamoyltransferase
ProfileScan IPR011761 553 752 PS50975 ATP-grasp fold
IPR011761 1023 1214 PS50975 ATP-grasp fold
ScanRegExp IPR012998 281 292 PS00442 Glutamine amidotransferase
IPR005479 584 598 PS00866 Carbamoyl-phosphate synthase L chain
IPR005479 651 658 PS00867 Carbamoyl-phosphate synthase L chain
IPR005479 1054 1068 PS00866 Carbamoyl-phosphate synthase L chain
IPR005479 1183 1190 PS00867 Carbamoyl-phosphate synthase L chain
IPR002195 1440 1448 PS00482 Dihydroorotase
IPR002195 1655 1666 PS00483 Dihydroorotase
IPR006130 1940 1947 PS00097 Aspartate/ornithine carbamoyltransferase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp