ORK01738

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01738

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01738
Clone name	hj01721
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PLCB4
cDNA sequence	DNA sequence (5339 bp) Predicted protein sequence (1193 aa)
HaloTag ORF Clone	FHC01738
Flexi ORF Clone	FXC01738
Description	1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 4 (EC 3.1.4.11) (Phosphoinositide phospholipase C) (Phospholipase C- beta-4) (PLC-beta-4).

Features of the cloned cDNA sequence

Description

Length: 5339 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1484 bp
Genome contig ID	gi51511747f_8897358
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTTCCAACTTCTCTAATAAAAAATTAAAACACGC
Flanking genome sequence (511764 - 511813)	----+--------+--------+--------+--------+----* ATAACACTCGTCAAGAGTATTTGCTCCCAAGACACATTCTAGCAAATGTT

Features of the protein sequence

Description

Length: 1193 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI17459	100.0	Phospholipase C...	Homo sapiens
Q15147	99.9	1-phosphatidyli...	Homo sapiens
XP_859719	98.5	similar to 1-ph...	Canis lupus fam...
XP_001493529	98.2	similar to phos...	Equus caballus
XP_001790252	97.7	phospholipase C...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	342	695	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	336	354	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	362	382	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	465	482	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	637	658	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	658	676	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	805	815	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	239	330	PF09279	EF-hand-like
	IPR000909	332	482	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	582	699	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	721	804	PF00168	C2 calcium-dependent membrane targeting
	IPR009535	925	982	PF06631	Protein of unknown function DUF1154
HMMSmart	IPR000909	331	481	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	583	699	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	720	819	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	331	481	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	583	699	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	706	804	PS50004	C2 calcium-dependent membrane targeting

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp