ORK01765

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01765

Order Kazusa clone(s) from :

Accession No	AB209288
Product ID	ORK01765
Clone name	fk06253
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CAMK2D
cDNA sequence	DNA sequence (2693 bp) Predicted protein sequence (522 aa)
HaloTag ORF Clone	FHC01765
Flexi ORF Clone	FXC01765
Description	Calcium/calmodulin-dependent protein kinase type II delta chain (EC 2.7.11.17) (CaM-kinase II delta chain) (CaM kinase II subunit delta) (CaMK-II subunit delta).

Features of the cloned cDNA sequence

Description

Length: 2693 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	719 bp
Genome contig ID	gi89161207r_114497214
PolyA signal sequence (AGTAAA,-34)	+--------+--------+----*----+---- TAGTAAACTGTTATTAACAGTTTACTACACTGTTC
Flanking genome sequence (504955 - 504906)	----+--------+--------+--------+--------+----* ATTATTAATTTGTGTAAGTTTGGGACATTAAATTGAAAATATACTGTATA

Features of the protein sequence

Description

Length: 522 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92525	2.3e-215	100.0	calcium/calmodu...	Homo sapiens
BAG10765	3.7e-202	100.0	calcium/calmodu...	synthetic construct
BAE28674	8.8e-202	100.0	unnamed protein...	Mus musculus
EAX06297	5.8e-195	96.5	calcium/calmodu...	Homo sapiens
AAX88806	4.3e-194	96.9	calcium/calmodu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	44	301	PD000001	Protein kinase
HMMPfam	IPR000719	44	302	PF00069	Protein kinase
HMMPfam	IPR013543	390	517	PF08332	Calcium/calmodulin dependent protein kinase II
HMMSmart	IPR001245	44	302	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	44	302	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	44	302	PS50011	Protein kinase
ScanRegExp	IPR000719	50	73	PS00107	Protein kinase
ScanRegExp	IPR008271	162	174	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	223	KPVDMWACGVILYILLVGYPPFW	245	PRIMARY	23