Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01772
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209415
Product ID ORK01772
Clone name pf00527
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SPTB
cDNA sequence DNA sequence (7481 bp)
Predicted protein sequence (2332 aa)
Flexi ORF Clone FXC01772
Description Spectrin beta chain, erythrocyte (Beta-I spectrin).
Features of the cloned cDNA sequence

Length: 7481 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 351 bp
Genome contig ID gi51511730r_64185426
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TGAGCCGAGGGGGCACAGGCCCCTTACCCCCAACC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGAGCTGGAGAAGGCTGATGGGGTTCTTCAAAC

Features of the protein sequence

Length: 2332 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92652 0 100.0 spectrin, beta,...
 Homo sapiens
BAG10800 0 100.0 spectrin beta c...
 synthetic construct
EAW80879 0 99.8 spectrin, beta,...
 Homo sapiens
XP_510006 0 99.3 spectrin beta i...
 Pan troglodytes
EAW80876 0 98.3 spectrin, beta,...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001605 2185 2204 PR00683 Spectrin/pleckstrin-like
IPR001605 2205 2226 PR00683 Spectrin/pleckstrin-like
IPR001605 2247 2264 PR00683 Spectrin/pleckstrin-like
IPR001605 2267 2285 PR00683 Spectrin/pleckstrin-like
HMMPfam IPR001715 59 162 PF00307 Calponin-like actin-binding
IPR001715 178 282 PF00307 Calponin-like actin-binding
IPR002017 306 416 PF00435 Spectrin repeat
IPR002017 426 530 PF00435 Spectrin repeat
IPR002017 532 639 PF00435 Spectrin repeat
IPR002017 641 745 PF00435 Spectrin repeat
IPR002017 747 850 PF00435 Spectrin repeat
IPR002017 852 956 PF00435 Spectrin repeat
IPR002017 958 1063 PF00435 Spectrin repeat
IPR002017 1065 1170 PF00435 Spectrin repeat
IPR002017 1172 1259 PF00435 Spectrin repeat
IPR002017 1278 1381 PF00435 Spectrin repeat
IPR002017 1393 1480 PF00435 Spectrin repeat
IPR002017 1482 1586 PF00435 Spectrin repeat
IPR002017 1588 1692 PF00435 Spectrin repeat
IPR002017 1694 1799 PF00435 Spectrin repeat
IPR002017 1801 1905 PF00435 Spectrin repeat
IPR002017 1907 2011 PF00435 Spectrin repeat
IPR002017 2013 2074 PF00435 Spectrin repeat
IPR001849 2183 2292 PF00169 Pleckstrin-like
HMMSmart IPR001715 60 160 SM00033 Calponin-like actin-binding
IPR001715 179 277 SM00033 Calponin-like actin-binding
IPR002017 309 415 SM00150 Spectrin repeat
IPR002017 429 529 SM00150 Spectrin repeat
IPR002017 535 638 SM00150 Spectrin repeat
IPR002017 644 744 SM00150 Spectrin repeat
IPR002017 750 849 SM00150 Spectrin repeat
IPR002017 855 955 SM00150 Spectrin repeat
IPR002017 961 1062 SM00150 Spectrin repeat
IPR002017 1068 1169 SM00150 Spectrin repeat
IPR002017 1175 1275 SM00150 Spectrin repeat
IPR002017 1281 1380 SM00150 Spectrin repeat
IPR002017 1386 1479 SM00150 Spectrin repeat
IPR002017 1485 1585 SM00150 Spectrin repeat
IPR002017 1591 1691 SM00150 Spectrin repeat
IPR002017 1697 1798 SM00150 Spectrin repeat
IPR002017 1804 1904 SM00150 Spectrin repeat
IPR002017 1910 2010 SM00150 Spectrin repeat
IPR002017 2016 2258 SM00150 Spectrin repeat
IPR001849 2183 2294 SM00233 Pleckstrin-like
ProfileScan IPR001715 58 162 PS50021 Calponin-like actin-binding
IPR001715 177 279 PS50021 Calponin-like actin-binding
IPR001849 2182 2292 PS50003 Pleckstrin-like
ScanRegExp IPR001589 60 69 PS00019 Actin-binding
IPR001589 134 158 PS00020 Actin-binding
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp