ORK01783

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01783

Order Kazusa clone(s) from :

Accession No	AB209614
Product ID	ORK01783
Clone name	sj09937
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	A2M
cDNA sequence	DNA sequence (4564 bp) Predicted protein sequence (1482 aa)
HaloTag ORF Clone	FHC01783
Flexi ORF Clone	FXC01783
Description	Alpha-2-macroglobulin precursor (Alpha-2-M).

Features of the cloned cDNA sequence

Description

Length: 4564 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	115 bp
Genome contig ID	gi89161190r_9011571
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GACTTGATGAATAAACACTTTTTCTGGTCAATGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTCCCTGTTTCCTGTTCATTCAATAAATATCATTGTACATTTCCATATG

Features of the protein sequence

Description

Length: 1482 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92851	100.0	alpha 2 macrogl...	Homo sapiens
AAT02228	99.7	alpha 2 macrogl...	Homo sapiens
BAG10847	100.0	alpha-2-macrogl...	synthetic construct
P01023	99.9	Alpha-2-macrogl...	Homo sapiens
AAA51551	99.8	alpha-2-macrogl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002890	22	296	PF01835	Alpha-2-macroglobulin
	IPR011625	463	618	PF07703	Alpha-2-macroglobulin
	IPR001599	746	840	PF00207	Alpha-2-macroglobulin
	IPR011626	1018	1274	PF07678	A-macroglobulin complement component
	IPR011627	1384	1471	PF07677	A-macroglobulin receptor
ScanRegExp	IPR010916	1	71	PS00430	TonB box
ScanRegExp	IPR001599	977	985	PS00477	Alpha-2-macroglobulin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp