ORK01808

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01808

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01808
Clone name	bm03196
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PGK1
cDNA sequence	DNA sequence (1798 bp) Predicted protein sequence (453 aa)
HaloTag ORF Clone	FHC01808
Flexi ORF Clone	FXC01808
Description	Phosphoglycerate kinase 1 (EC 2.7.2.3) (Primer recognition protein 2) (PRP 2) (Cell migration-inducing gene 10 protein).

Features of the cloned cDNA sequence

Description

Length: 1798 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	434 bp
Genome contig ID	gi89161218f_77146384
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATGATCCATTAAGTAAACAATAAAAGTGTCCATTG
Flanking genome sequence (122035 - 122084)	----+--------+--------+--------+--------+----* AAACCGTGATTTTTTTTTTTTTCCTGTCATACTTTGTTAGGAAGGGTGAG

Features of the protein sequence

Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
2ZGV	1.7e-170	99.7
P00558	3.6e-170	100.0	Phosphoglycerat...	Homo sapiens
Q5NVB5	8.9e-170	99.7	Phosphoglycerat...	Pongo abelii
CAG32997	8.9e-170	99.7	PGK1 [Homo sapi...	Homo sapiens
AAX41039	1.2e-169	99.7	phosphoglycerat...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001576	49	65	PR00477	Phosphoglycerate kinase
	IPR001576	70	92	PR00477	Phosphoglycerate kinase
	IPR001576	150	165	PR00477	Phosphoglycerate kinase
	IPR001576	193	215	PR00477	Phosphoglycerate kinase
	IPR001576	222	244	PR00477	Phosphoglycerate kinase
	IPR001576	245	264	PR00477	Phosphoglycerate kinase
	IPR001576	369	394	PR00477	Phosphoglycerate kinase
	IPR001576	405	416	PR00477	Phosphoglycerate kinase
	IPR001576	428	445	PR00477	Phosphoglycerate kinase
HMMPfam	IPR001576	39	450	PF00162	Phosphoglycerate kinase
ScanRegExp	IPR015911	54	64	PS00111	Phosphoglycerate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp