Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01810
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01810
Clone name bm03911
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PES1
cDNA sequence DNA sequence (2218 bp)
Predicted protein sequence (595 aa)
Flexi ORF Clone FXC01810
Description pescadillo homolog 1, containing BRCT domain (zebrafish)
Features of the cloned cDNA sequence

Length: 2218 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 414 bp
Genome contig ID gi89161203r_29202619
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
GAGCATTTGTTATTAAATGACTGGACTTTTGTGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTGCATTTTGTGTCCATGAGCCTTCCTAGGGTTGGAGGAGGCCTACCT

Features of the protein sequence

Length: 595 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O00541 1.1e-208 100.0 Pescadillo homolog.
Homo sapiens
AAX29932 1.1e-208 100.0 pescadillo-like...
synthetic construct
AAX42489 2.8e-208 99.8 pescadillo-like...
synthetic construct
XP_001143647 8.1e-207 99.3 pescadillo homo...
Pan troglodytes
CAG30425 7.2e-206 99.1 PES1 [Homo sapi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010613 13 294 PF06732 Pescadillo
IPR001357 329 409 PF00533 BRCT
HMMSmart IPR001357 331 412 SM00292 BRCT
ProfileScan IPR001357 329 422 PS50172 BRCT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp