ORK01811

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01811

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01811
Clone name	bm01306
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	NAP1L1
cDNA sequence	DNA sequence (2236 bp) Predicted protein sequence (414 aa)
HaloTag ORF Clone	FHC01811
Flexi ORF Clone	FXC01811
Description	Nucleosome assembly protein 1-like 1 (NAP-1-related protein) (hNRP).

Features of the cloned cDNA sequence

Description

Length: 2236 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	985 bp
Genome contig ID	gi89161190r_74627491
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTGGAACGAGATGCTATACTAATAAGCAAGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGAGGAAGAAAATCTTAAGTGATTGATGCTGTTTT

Features of the protein sequence

Description

Length: 414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P55209	9.3e-144	100.0	Nucleosome asse...	Homo sapiens
AAP36422	9.4e-144	100.0	nucleosome asse...	synthetic construct
XP_001103652	1.4e-143	99.7	nucleosome asse...	Macaca mulatta
A6H767	2.7e-143	99.2	Nucleosome asse...	Bos taurus
Q5R4D4	4.6e-143	99.4	Nucleosome asse...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002164	98	371	PF00956	Nucleosome assembly protein (NAP)

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VTACAAPAAWLPILVADIWSSYN	23	PRIMARY	23