Length: 2236 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
985 bp |
Genome contig ID |
gi89161190r_74627491 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- CTTTGGAACGAGATGCTATACTAATAAGCAAGTGT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAGAGGAAGAAAATCTTAAGTGATTGATGCTGTTTT |
Length: 414 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
P55209 |
9.3e-144 |
100.0 |
Nucleosome asse...
|
Homo sapiens
|
AAP36422 |
9.4e-144 |
100.0 |
nucleosome asse...
|
synthetic construct
|
XP_001103652 |
1.4e-143 |
99.7 |
nucleosome asse...
|
Macaca mulatta
|
A6H767 |
2.7e-143 |
99.2 |
Nucleosome asse...
|
Bos taurus
|
Q5R4D4 |
4.6e-143 |
99.4 |
Nucleosome asse...
|
Pongo abelii
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR002164 |
98 |
371 |
PF00956 |
Nucleosome assembly protein (NAP) |
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
1 |
VTACAAPAAWLPILVADIWSSYN |
23 |
PRIMARY |
23 |