Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01812
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209817
Product ID ORK01812
Clone name bm04495
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AP4B1
cDNA sequence DNA sequence (2372 bp)
Predicted protein sequence (771 aa)
Flexi ORF Clone FXC01812
Description AP-4 complex subunit beta-1 (Adapter-related protein complex 4 beta 1 subunit) (Beta subunit of AP-4) (AP-4 adapter complex beta subunit).
Features of the cloned cDNA sequence

Length: 2372 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 9 bp
Genome contig ID gi89161185r_114139201
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAACAATTGAAGAAATAAAATCATAACAGAGTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTTGCTTGTCTAGAGTAAGATGAATAACTATTACACTTTCTTAGTCTTTC

Features of the protein sequence

Length: 771 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93054 0 100.0 adaptor-related...
Homo sapiens
BAG10946 0 100.0 AP-4 complex su...
synthetic construct
AAD20448 0 99.8 AP-4 adaptor co...
Homo sapiens
Q9Y6B7 0 99.8 AP-4 complex su...
Homo sapiens
BAG37203 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002553 39 558 PF01602 Clathrin/coatomer adaptor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp