Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01813
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01813
Clone name bm04664
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FN3KRP
cDNA sequence DNA sequence (1752 bp)
Predicted protein sequence (313 aa)
Flexi ORF Clone FXC01813
Description Ketosamine-3-kinase (EC 2.7.1.-) (Fructosamine-3-kinase-related protein).
Features of the cloned cDNA sequence

Length: 1752 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 808 bp
Genome contig ID gi51511734f_78167907
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
CATGAATGGCATTGATGCTAATAAATCCTTTGCAC
Flanking genome sequence
(111239 - 111288)
----+----*----+----*----+----*----+----*----+----*
AAAAATTTGAATAAACTTCCAGTGGTTTCGATAACGTACAAGATTGTATA

Features of the protein sequence

Length: 313 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9HA64 1.5e-134 100.0 Ketosamine-3-ki...
Homo sapiens
EAW89818 1.6e-134 100.0 fructosamine-3-...
Homo sapiens
BAB13992 3.8e-134 99.6 unnamed protein...
Homo sapiens
BAG37766 8.2e-134 99.6 unnamed protein...
Homo sapiens
XP_523753 8.5e-133 98.7 fructosamine-3-...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005581 8 310 PF03881 Fructosamine kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp