ORK01817

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01817

Order Kazusa clone(s) from :

Accession No	AB209838
Product ID	ORK01817
Clone name	bm05685
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ACP1
cDNA sequence	DNA sequence (1474 bp) Predicted protein sequence (165 aa)
HaloTag ORF Clone	FHC01817
Flexi ORF Clone	FXC01817
Description	Low molecular weight phosphotyrosine protein phosphatase (EC 3.1.3.48) (LMW-PTPase) (LMW-PTP) (Low molecular weight cytosolic acid phosphatase) (EC 3.1.3.2) (Red cell acid phosphatase 1) (Adipocyte acid phosphatase).

Features of the cloned cDNA sequence

Description

Length: 1474 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	976 bp
Genome contig ID	gi89161199f_154944
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- AAACTGGGGAGTTATAAAAATACAACTAGAGATAT
Flanking genome sequence (113338 - 113387)	----+--------+--------+--------+--------+----* AAATCTGGTGTCTGCCTGTTTTTTTATTGACAGGTAAGGAAGCATTTGAA

Features of the protein sequence

Description

Length: 165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93075	1.2e-71	100.0	acid phosphatas...	Homo sapiens
AAI06012	1.5e-68	100.0	Acid phosphatas...	Homo sapiens
P24666	4e-68	99.3	Low molecular w...	Homo sapiens
AAB22514	4.7e-68	100.0	acid phosphatas...	Homo sapiens
AAB20259	1.2e-67	99.3	acid phosphatas...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000106	16	33	PR00719	Protein-tyrosine phosphatase
	IPR002115	35	47	PR00720	Protein-tyrosine phosphatase
	IPR000106	59	75	PR00719	Protein-tyrosine phosphatase
	IPR002115	78	93	PR00720	Protein-tyrosine phosphatase
	IPR000106	92	107	PR00719	Protein-tyrosine phosphatase
	IPR002115	95	115	PR00720	Protein-tyrosine phosphatase
	IPR000106	117	130	PR00719	Protein-tyrosine phosphatase
	IPR002115	117	133	PR00720	Protein-tyrosine phosphatase
	IPR000106	135	150	PR00719	Protein-tyrosine phosphatase
	IPR002115	142	163	PR00720	Protein-tyrosine phosphatase
HMMPfam	IPR000106	14	163	PF01451	Protein-tyrosine phosphatase
HMMSmart	IPR000106	14	163	SM00226	Protein-tyrosine phosphatase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp